LL295388 LL295388

04-06-2021
Mathematics

contestada

The measure of angle NOP is:140 What is the value of x?

The measure of angle NOP is140 What is the value of x class=

Respuesta :

senalvidun senalvidun

04-06-2021

Answer:

value of X

x+23 =140

x. =140-23

x. =117

Answer Link

itsbriofc itsbriofc

04-06-2021

Answer:

Hello! answer: x = 117

Step-by-step explanation:

140 - 23 = 117

therefore x = 117 Hope that helps!

Answer Link

Otras preguntas

what is the author's purpose in using a mirror as a symbol?

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Social networks and the reciprocal norms associated with these networks that encourage people to do things for each other are known as a. social capital. c. net

The Gobi Desert is located in which quadrant on the map 1 2 3 4 5

An arrow with a mass of 0.0180 kg enters a block of foam traveling at 138 ms and comes to a stop in 0.0042 s. The arrow entered into the block at a distance of

Can someone help me out

2000 tickets were sold in an exhibition on Saturday. The cost of a ticket for an adult is $4 and for a child is $2. The total amount collected on Saturday was $

Despite the environmental laws,the 1947 Tongass Timber Act guaranteed

got a poem using personification and stanzas?

What is the surface area of this cylinder? Use a * 3.14 and round your answer to the nearest hundredth. 28 ft ----------- 15 ft square feet Submit