rosalia2020 rosalia2020

12-05-2020
Biology

contestada

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Respuesta :

samchavez8277 samchavez8277

18-05-2020

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

Answer Link

Otras preguntas

ASAP! WILL MARK BRAINLIEST FOR FIRST ACCURATE ANSWER!! Using the given equation find the missing coordinates of the points and then find the slope of the line f

12 more than the number 5 and a x

Brian has 5 cups of chacolate chips. The recipe calls for 1/3 cup of chocolate chips. How many batches will the 5 cups make?

Why do the townspeople stone people in their community in the short story "The Lottery?"

What happens to carbon when a candle burns

Compare the two samples

what is the slope of -6,6 and 4,-4

Can you simplify the equation 64x(squared)-112x+49

if the car spends 2.5 hours going 40 miles per hour on the trip, how long does it spend going 25 miles per hour(round the nearst hundreth)

1 + 4 = 5 2 + 5 = 12 3 + 6 = 21 8 + 11 = ?