sammiii85 sammiii85
  • 15-11-2020
  • Mathematics
contestada

Jim biked 2 3/4
miles on Monday and then 3 5/8 miles on Tuesday. How many miles did he bike in
total?

Respuesta :

avyuktiyer10
avyuktiyer10 avyuktiyer10
  • 15-11-2020

Answer:2 3/4+ 3 5/8= 6 3/8

Step-by-step explanation:

2 3/4= 2 6/8+3 5/8=5 11/8=6 3/8

Answer Link

Otras preguntas

Bdbdjekdmfmfmfkfmf help
what is the function of RBC
Alfredo es de Puerto Rico. Él es (Puerto Rican).
Help ASAPPP PLEASEEE AND THANK YOUUY
A new one-year membership at RecPlex costs $160. A registration fee of $28 is paid up front, and the rest is paid monthly. How much do new members pay each mont
What is the hormone secreted by the testes? a) Gonad b) Androgen c) Estrogen d) Testes hormone
u+(−5)=−15 What do do to the negative 5 if its ib parentheses
The mark obtained by Belij in an exam is 28 out of 40, express his obtained marks in percentage​
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Describe the opinions of W.E.B Du Bois and Booker T Washington regarding the pursuit of equal rights. How are they the same and how are they different.