ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

How are speech, music, and sound effects captured?

Enlargement of body tissue blurred vision low sperm count weight gain feeling sluggish

examples of how the colonists responded to the numerous taxes passed by the british

Rich deposited money into a bank account that earned 2.5% simple interest each year. After 2 years, he had earned $14.65 in interest on the account. If no other

A spinner can land on either red, blue, green, or yellow (the wedges are the same size). you spin twice. what is the probability that you land on blue on your f

What is the length of BC? ____ Units

Vietnam proved to be a tough challenge for American soldiers because of what? A. Boot traps B. Chu chi trails C. Hit and run tactics D. The difficult terrain su

Select the description of an exon.

Rukmani is surprised to discover that her new house is _____. so close to her neighbors that she can hear them talking at night made of cinder blocks and is muc

Michelle is the department head of an african studies program at a local college. when carmen, a latina student, wants to enroll in the program, michelle refuse