ChipSoSmoove ChipSoSmoove

13-11-2020
History

contestada

why did the U.S play a major role in the middle east in the 21st century

Respuesta :

vmali4566 vmali4566

19-11-2020

Explanation:

United States foreign policy in the Middle East has its roots in the 18th century Barbary Wars in the first years

Answer Link

Otras preguntas

Walmart sells numerous products, including packaged food, produce, automotive maintenance services, eyeglasses, clothing, and toys. Walmart advertises itself as

White (colorless) diamonds are composed of pure carbon in a solid lattice. Some diamonds found in nature are observed to have a color, which comes from a trace

Which describes the Mongols' rise to power?A. they used a powerful navy to defeat their enemiesB. they sacked the city of ConstantinopleC. their powerful leader

Complete the equation of the line through (-6,5)(−6,5)left parenthesis, minus, 6, comma, 5, right parenthesis and (-3,-3)(−3,−3)left parenthesis, minus, 3, comm

Beloved Baby Company manufactures and sells children's strollers. Each stroller requires eight screws. For September, Beloved Baby Company will begin September

facts about health behavior

A 120-V motor has mechanical power output of 2.10 hp. It is 80.0% efficient in convertingpower that it takes in by electrical transmission into mechanicalpower.

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

I am giving a brainliest to the best answer

What is the distributive property of 3(5+6)