drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

Tells you whether a material is a solid liquid or gas

Jeremiah has a previous balance of $594 on a credit card with a 12.7% APR compounded monthly. If he made a payment of $25 this month, what is the new balance on

Cellular respiration requires fuel (glucose) and oxygen gas. the main process that produces these inputs is _____.

A bucket will hold 20 liters of water. How many centiliters will it hold?

some students were asked to write a composite number. which student did not write a composite number?

Add: x 5 - 4x 4 + 7x 3 + 8, 9x 3 + 7x 2 - 10, and -2x 5 + 7x 4 - 3x + 8

How to allow all users to access a program?

The healthcare provider orders potassium chloride 30 meq po q8h for an adult with hypokalemia. if the recommended adult dose is 10dash–100 meq/d po in divid

Le 3-3. assume that zimbabwe and portugal each has 60 machine minutes available. originally, each country divided its time equally between the production of too

"You know that David my father could not build a house for the name of the LORD his God because of the wars which were about him on every side, until the LORD