FakeyourDiet FakeyourDiet

03-11-2020
Geography

contestada

Rewrite each equation in slope-intercept form. Then determine whether the lines are perpendicular. Explain

Rewrite each equation in slopeintercept form Then determine whether the lines are perpendicular Explain class=

Respuesta :

Аноним Аноним

03-11-2020

Answer:

flip the fist one 6x1=6

2 one is 20/1

3 one is 4/8 6

4 is 8+18=27x2=57

5 is 6+4=10x2=20

6 is 6+5=11x2=22

hope i helped

Explanation:

Answer Link

Otras preguntas

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Boden’s account has a principal of $800 and a simple interest rate of 3.3%. Complete the number line. How much money will be in the account after 4 years, assum

Which statement most accurately compares epic poetry and lyric poetry? A. Epic poetry tends to be long, whereas lyric poetry tends to be short B. Epic poetry fo

Which country surrounds Lesotho? A. Swaziland B. South Africa C. Botswana D. Namibia

The following map shows the Crusades from 1095 A.D. (CE) through 1204 A.D. (CE). Use the map to answer the following question: What does the origin of many of t

What is the World Wide Web? How has it affected video?

13. What is the best way to use in separating iron parts from a mixture?A. Filter paper

Petrified wood is a beautiful material that forms over thousands of years. It occurs when forests get covered in rock and sediment. Which statement is true? 1.

1234567890987654321qwertyuiooplkjhgfdsazxcvbnnm