arinsuhang96 arinsuhang96

11-08-2020
Mathematics

contestada

How many variables terms are in the expression 3xcube y+5xsquare+y+9

Respuesta :

galosergo galosergo

11-08-2020

Answer: Please Give Me Brainliest, Thank You!

2

Step-by-step explanation:

There are two variables here, X and Y

Answer Link

Otras preguntas

PLZ HELP ASAP NO LINKS!!! Line A is perpendicular to Line B. If the slope of Line A is - 3/4, what is the slope of Line B? ?/?

Unit Test Active 11 12 TIME REI 01:4 Which order shows the levels of organization from largest to smallest? O organism, organ system, cell, organ, tissue O orga

Marx saw religion as the opiate of the people. True or False

When Junior goes back to school, how do the people at Reardan treat him? How does this reflect his previous statement about their only being “two tribes”?

What is the equation for the line that passes through the points (-5.5, 2.5) and (-2.5, -3.5) questions are: A) y= 2x + 13.5 B) y= x - 1 C) y= -2x + 1.5 D) y= -

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

What is the surface area? A: 61.2 B: 87.21 C: 41.31 D: 15.3

What are the types of changes that occur when matter is heated ? Which of these changes produce new substances ?

In your closet you have three shirts (red, green, blue), four pairs of pants (blue, black, brown, gray), and two pairs of sneakers (Nike, Adidas) a. How many di

Select the expression that represents the following statement: 3 times one fourth the difference of 26 and 10. (4 points) one fourth x (26 + 10) x 3 one fourth