RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult
  • 14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

What is an introduction given before a piece of music that is perforned to indicate the tempo
After clicking the Start button on your computer screen desktop, what option would you then select to examine system components you might want to modify? A. F
This desert extends into Northern China
In what respects was Japan's 19th century transformation revolutionary?
a machine can produce 250 items per hour. if the operator of the machine works 40 hours per week, how many times are made by this machine in one year?
How can we prove that 4x+2(x+3)=8x+6
What does it mean to call someone a “Benedict Arnold”?
Which elements are represented by the symbols S and Na?
Why can't chemical changes be reversed?
Which pair of ratios form a proportion? A. 3 : 4 and 4 : 5 B. 10 : 12 and 16 : 18 C. 7 : 10 and 10 : 14 D. 5 : 8 and 20 : 32