iloveduar9dNej iloveduar9dNej

11-08-2016
Mathematics

contestada

Use the list method to write "the perfect square integers between 1 and 80 inclusive".

Respuesta :

trinityalford trinityalford

17-08-2016

all of our square numbers from 1 to 80 are 1, 4, 9, 16, 25, 36, 49, 64.

Answer Link

Otras preguntas

a short term affect of anorexia might include wight loss

Rhonda and Marta form Yo Yo Corporation. Rhonda transfers land (basis of $55,000 and fair market value of $180,000) for 50 shares plus $20,000 cash. Marta trans

The time, t and velocity, V are related by the equation V = pq^t, where p and q are constant. a) Transform the relationship V = pq^t into straight line form

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Label the part of speech of each underlined word

Use Pascal’s Triangle to determine the fifth term of the expansion of (x − 5)6.

Which of the following equations is equivalent to y = 2x + 1? A. 2x + y = 1 B. x + 2y = 1 C. -2x + y = 1 D. -2x - y = -1

Which equation is represented by Ms. Wilson's model? O n? + 3n + 40 = (n-3)(n-5) O n2 + 13n + 40 = (n + 8) (n + 5) O n2 + 40n + 13 = (n + 8)(n + 5) On2 + 40n +

Which hypothetical statement about Brutus would be an example of situational irony?

A DNA sequence of interest was digested and ligated into the middle of the AmpR gene region of pBR322 vector. The vector also contains a TetR gene which is not