mee2939
mee2939
04-06-2019
Mathematics
contestada
Find the y-intercept of the parabola y = x2 - 5.
Respuesta :
ireenee43
ireenee43
04-06-2019
(0,-5) is the y-intercept
Answer Link
VER TODAS LAS RESPUESTAS ( 13+ )
Otras preguntas
7. Which two substances do geologists use in radiocarbon dating? A carbon-12 and carbon-10 OB carbon-14 and carbon-12 C lead-206 and carbon-14 D carbon-14 and u
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
You walk with a velocity of 2 m/s north. You see a man approaching you, and from your frame of reference he has a speed of 3 m/s to the south. What is the veloc
Which function requires the muscular, skeletal, and nervous systems to work together?
It cost a farmer 43.60 pre acre to harvest corn. How much does it cost to harvest 1325.5 acres
A triangular flower bed (space for planting flowers) needs a thin metal border all the way around it. The sides are 7 feet, 6 feet, 9 feet long. How many feet o
1) Explain stateful autoconfiguration and which Windows Server 2016 role enables use of this technology on a network. 2) Which of the following applies to a DN
Which of the following is the BEST example of increasing the intensity of a workou
35. A pilot can travel 400 miles with the win amount of time as 336 miles against the wind. Find of the wind if the pilot's speed in still air is 230 mi hour. t
A pair of shoes usually sells for $63. If the shoes are 20% off,and sales tax is 5%, what is the total price of the shoes, including tax?
