juliemiller56191 juliemiller56191

13-09-2018
Mathematics

contestada

please please please help I really need help I will give you 10 points!

please please please help I really need help I will give you 10 points class=

Respuesta :

jonh123 jonh123

13-09-2018

5.057 because 3.89 times 1.3 = 5.057

Answer Link

Otras preguntas

What is the exact perimeter of kite UVWX?

Kinetic energy is the energy an object has due to its _____.

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

*****PLEASE HELP*****Given the figure, if ∠ABC is 20° and C is the center of the circle, what is the measure of the central angle ∠ACB?A) 40° B) 70° C) 100° D)

why do you think joe needs to know what is happening in his own neighborhood

1. ¿Dónde practica deportes Victoria? 2. ¿Qué pasa este fin de semana? 3. ¿Cuándo hay paseos en bicicleta? 4. ¿Qué hace Victoria por las tardes? 5. ¿Qué de

The IV order is to infuse Ciprofloxacin 100 mg in 50 mL 0.9% NS q.12h. The pharmacy sends the mixed IVPB with instructions to infuse over 45 minutes. The drop f

Joseline met William in Paris in a?

What were the three key elements of the Catholic reformation, and why were they so important to the Catholic Church in the 16th century?

In the context of team compensation and recognition, _____ encourage employees to acquire the abilities that they will need to perform multiple jobs within a te