mattiehorseyp4f7y1 mattiehorseyp4f7y1
  • 04-05-2018
  • History
contestada

why were slaves examined by doctors before the were purchased?

Respuesta :

HColdAndForsaken
HColdAndForsaken HColdAndForsaken
  • 04-05-2018
I would have to guess that doctors examined slaves for the simple purpose to check their health to make sure that they can handle field work. If not they would most likely be sold for inside work like cleaning, cooking, etc.
Answer Link

Otras preguntas

how do you say theatre in Spanish
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
why is the square root of a perfect square always rational
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Susan ........ (Run) to school because she was late.
What kind of problems did increased urbanization cause? During time of industrial revolution
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?