tomczytoms tomczytoms

15-09-2015
Social Studies

contestada

Let me know who was one of last white president in US

Respuesta :

WorldCitizen WorldCitizen

15-09-2015

If I understand your question correctly, you want to know who the last (as of today) "white" president was of the US? It was George W. Bush, president until 2009.

Answer Link

Otras preguntas

Assume that you manage a risky portfolio with an expected rate of return of 17% and a standard deviation of 27%. The T-bill rate is 7%. Your risky portfolio inc

"Suppose a bank has an asset duration of 5 years and a liability duration of 2.5 years. The bank has $1,000 million in assets and $750 million in liabilities. I

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

Which of the following is in the correct order for one cycle of polymerase chain reaction (PCR)? Which of the following is in the correct order for one cycle of

what is demand for supply

Why do elements in the same family generally have a similar properties ?

Why are the moon and earth able to exert a force on each other A.the Force of static electricity holds the two objects together in orbit B.The force of tension

For all values of x and y, which expression is equivalent to 8x + 6y?

Advent Automobiles Inc. has launched a new sport utility vehicle (SUV). It's advertising firm develops a marketing message and places advertisements in leading

graph the linear equation. 4x+6y= -12