sharonbland4455 sharonbland4455
  • 03-10-2017
  • Mathematics
contestada

Which expression is equal to (5−2i)−(1+3i)?


4+3i
4+i
6−5i
4−5i


Which expression is equal to −2i(−9+6i) ?


−12+18i
18−12i
18+12i
12+18i

Respuesta :

alexistriplettovep6q alexistriplettovep6q
  • 17-09-2018

first one is 4-5i

second one is 12+18i

Ver imagen alexistriplettovep6q
Ver imagen alexistriplettovep6q
Answer Link
darlaengler7
darlaengler7 darlaengler7
  • 11-11-2021

Answer:

thank you! my answer is C) 4-5i and I got an 100% on the unit test.

Step-by-step explanation:

thanks for your help...

have a great day!

Answer Link

Otras preguntas

How did some Catholics respond to this religious discrimination?
Which of the following best explains why kepler 10b is called a “super-earth”?
You must read this short story to understand the question: It all began with Effie's getting something in her eye. It hurt very much indeed, and it felt somethi
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
I need to know how to do this simple question
Which number is a solution to the inequality? 6 > z(10 - z) a. 0 b. 1 c. 2 d. 3
Who uses the river nile
What is ethnic cleansing? A. the practice of removing members of an ethnic group from a region by force or intimidation B. a group of people boun
A pizza baker uses 2.5 cups of flour to make each large pizza. If f represents the number of cups of flour, which equation models this situation
la estudiante __________ (patinar) en el parque