Seudónimo Seudónimo
  • 01-10-2017
  • Computers and Technology
contestada

What does PRAM stand for?

Respuesta :

Аноним Аноним
  • 01-10-2017
PRAM- Phase-Change Random Access Memory
Answer Link
Аноним Аноним
  • 01-10-2017
Hello There!

It stands for Parameter Random Access Memory.
It is a type of memory that stores system settings.

Hope This Helps You!
Good Luck :)

Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
How do you write fifty-seven thousand,eighteen. In standard form
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
what is the most common type of vegetation throughout Latin America
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
What is the additive inverse of -4a
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
What is the difference between "Herr" and "Herrn"?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
round 7,782 to the nearest hundred