Maree
Maree Maree
  • 02-05-2014
  • Mathematics
contestada

Which decimal is equivalent to 13/20?

Respuesta :

Abby96 Abby96
  • 02-05-2014
The decimal that is equivalent to 13/20 is 0.65.
Answer Link
kate200468
kate200468 kate200468
  • 02-05-2014
[tex] \frac{13}{20} = \frac{13\cdot5}{20\cdot5} = \frac{65}{100} =0,65[/tex]
Answer Link

Otras preguntas

Which political party lost popularity because of us involvement in korea?
Who was osama bin laden? a. shah of iran b. president of iraq c. a soviet dictator d. leader of al-qaeda?
A line goes through the points (1, 2) and (5, 10). Which of the following is the equation of the line? y = 4x − 2 A:y = 2x B:y = 3x − 1 C:y = x + 5 D:y = 3x − 5
What is the value of x in the equation –6 + x = –2? 8 4 –4 –8
PLEEASSE HELP NOW!! It's multiple choice!
I need help with 6-9 and fast plz and thxs
If you were scientists examining the DNA sequence of two unknown organisms that you hypothesize share a common ancestor, what evidence would you expect to find?
A stone that starts at rest free falls for 7.0 s. How far does the stone fall in this time?
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
Which of these was NOT an effect of the Industrial Revolution?A)increased organization of workersB)English settlement of the New WorldC)increased competition be