missisland4736 missisland4736
  • 13-09-2022
  • Biology
contestada

What problem would most likely occur if a haploid cell attempted to perform meiosis.

Respuesta :

MarioDario
MarioDario MarioDario
  • 13-09-2022
Meiosis needs to begin with a diploid cell because the 4 chromosomes within that one cell will split into two, leading to two chromosomes in two cells, then these breakdown further into four cells with one chromatid making four gametes total. If a haploid attempted this, we wouldn’t have enough chromosomes to properly split and have the exact amount of chromosomes required to make a gamete.
Answer Link

Otras preguntas

explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
how would u form a superlative for the adverb widely
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
31+34=90-n 45+1=70-k 6×9=41+m
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Graph the first six terms of a sequence where a1 = -10 and d = 3.
How has water influenced the development of civilization in Africa
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?