michellekout03 michellekout03

13-09-2022
Mathematics

contestada

The ratio of the weight of an object on Mars to the weight of an object on Earth is 0.4 to 1. How much will a 174 lb
astronaut weigh on Mars?

Respuesta :

Otras preguntas

Susan bought 15 pounds of flour for 6 dollars how many pounds of flour did per dollar

what part of the neuron releases neurotransmitters

BRAINLYEST AND LOTS OF POINTS PLEASE HELP what does the mitochondria most resemble in the human body and why

Helppppp !!!!!! 5a + ( -5 ) - 3a + 10b - 3 - b = ?

Roger is legally blind. His vision impairment is a complication of diabetes mellitus. Can you describe what structural changes in Roger's eyes have caused his b

which new instruments were introduced in the different eras

What was one effect of the Great Awakening?

Solve for RN. 50 points in it for you plus a thanks, 5 star rate and brainliest!

What caused European explorers go to the Americas in the late 1400s? overpopulation in Europe desire to create a new nation desire to learn Native American cult

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'