thatonechild thatonechild

15-07-2022
Biology

contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154

15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

If we consider Maslow's hierarchy of needs in the context of Japan, Greece, and Mexico, where uncertainty-avoidance characteristics are strong, then ________ ne

If a car travels at an average speed of x miles per hour, how far would the car travel in 90 minutes?

What was Dada art a reaction to? a. Spanish-American War b. World War I c. World War II d. the start of Communism

How does in Verto fertilization work

Which was an advantage for the North at the start of the Civil War? a larger population a well-led army fewer railroads a fighting spirit

Can someone explain this to me? I really don't understand how to do it. I need help ASAP

Read the statement. The solubility of sugar is 204 g/ 100 g water at 20 °C. How many grams of water are needed to dissolve 612 grams of sugar at the same tempe

If two integers have the same absolute value,which of the following is true about the integers A.They must be the same integer B. They must be opposite intege

How did the land and climate of southern colonies affect agriculture

Math pls help ASAP !