94c9ndjm9v 94c9ndjm9v
  • 03-04-2022
  • Mathematics
contestada

The perimeter of a quarter circle is 3.57
yards. What is the quarter circle's radius?
P = 3.57 yd

The perimeter of a quarter circle is 357 yards What is the quarter circles radius P 357 yd class=

Respuesta :

Аноним Аноним
  • 03-04-2022

Given -

  • The perimeter of a quarter circle is 3.57
  • yards. ie, P = 3.57 yd

To find -

  • the quarter circle's radius

Solution -

We know to find the perimeter of the quarter of a circle we use the formula,

1/4 × circumference of the circle

= 1/4 × 2πr

= 1/4 × 2×3.14×3.57

= 2.8 yards

Answer Link

Otras preguntas

_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
why did russia have revolution in 1917?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
Which word has the long i sound? relieve speciality society social
3+1/4x greater than 11
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Explain who or what "Año Viejo" is and its significance.