huffg887 huffg887

13-02-2022
Social Studies

contestada

What’s an element named after a place

Respuesta :

ballam1072004 ballam1072004

13-02-2022

Answer:

Americium (America), Francium (France), Germanium (Germany), Nihonium (Japan or Nihon), Polonium (Poland)

Answer Link

Otras preguntas

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

Solve for x. Assume that lines which appear tangent are tangent.

A child finds 30 nickels and dimes between sofa cushions. how many dimes did the child find if the total value of the coins is $1.90?

When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False

who invented the glass harmonica

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you’re over 21 you could be arrested for a DUI if your PAC is at or over ? Thanks

Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a