Seudónimo Seudónimo
  • 16-01-2022
  • Mathematics
contestada

Which of the graphs are just a relation?​

Which of the graphs are just a relation class=

Respuesta :

mathstudent55
mathstudent55 mathstudent55
  • 16-01-2022

Answer:

C, D

Step-by-step explanation:

Graphs A and B pass the vertical line test, so they are functions.

Graphs C and D do not pass the vertical line test, so they are not functions. They are just relations.

Answer Link

Otras preguntas

Very hot magma rises toward the surface because it is less dense. The magma becomes as it cools, and back toward the core form in the mantle where hot magma ke
PLS HELP ME PLS IT"S DUE
At a state university on the west coast, 13% of undergraduate students are of Asian origin. Among students of Asian origin, 11% major in Humanities, 7% in Socia
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
The graph showsf(x)and its transformationg(x). Enter the equation for g(x) in the box. g(x) =
Identify whether each phrase is an expression, equation or inequality.
What is a social graph? Group of answer choices Maps group contacts identifying who knows each other and who works together. Describes the collaborative activit
how to say youre joking in french
Write an equation that has an a-value of -2, a b-value of 1, and a c-value of 3.
AOB and COD are two straight lines. Find ZBOD. help