jok
jok jok
  • 02-01-2017
  • Computers and Technology
contestada

Which of the following contributes to your active digital footprint

Respuesta :

mielaa123 mielaa123
  • 02-01-2017
personal information intentionally put on a secure website
Answer Link
mandoguy
mandoguy mandoguy
  • 02-01-2017
Ip I guess i dont really understand what you are wanting
Answer Link

Otras preguntas

all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Give a recursive algorithm for finding the sum of the first n odd positive integers.
Help pl0x, Algebra 1
does a human body use neon???
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?