jazmynvansteenvoort jazmynvansteenvoort

11-10-2021
Mathematics

contestada

please help

Simplify 3 - (2- 8).

O -1
O 7
O -7
O 9

Respuesta :

Yang100 Yang100

11-12-2021

Answer:

9

Step-by-step explanation:

3-(2-8)

3-(-6)

3+6

9

Answer Link

Otras preguntas

What is the vertex of y=2x^2-8x+6?

What can you do if you cannot find information about an author’s credentials?

(-6)^-12(-6)^5(-6)^2

Which groups were not a part of the prosperity of the late 1800s? Choose all the answer that are correct. A. slum residents. B. Unskilled workers. C. government

Why were the Russian people unhappy with their country’s involvement in world war l ?

At a school, 40% of sixth grade students said that hip-hop is their favorite kind of music. If 100 sixth grade students prefer hip-hop music, how many sixth gra

Which of the following stands out in Native American culture compared to the cultures of early river valley civilizations? A. craftsmanship B. weaponry C. poly

How do contractile vacuoles help a cell with homeostasis? They regulate water intake and excretion. They maintain the structure of cell walls. They obtain food

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Which factor contributed to Abraham Lincoln issuing the Emancipation Proclamation? A. He was a strong abolitionist. B. He needed the freed slaves to fight as so