Seudónimo Seudónimo

03-08-2021
Mathematics

contestada

Input in standard form the equation of the given line. The line that passes through (1, 1) and (3, 4)

Respuesta :

officialmelle officialmelle

03-08-2021

ANSWER:
y=3/2x-1/2

Standard Form Equation: y=mx+b

Answer Link

Otras preguntas

Create an image of rectangle ABCD that is translated 6 units to the right and 3 units up by plotting the corresponding vertices. Plot the vertex that correspon

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

I need help with finding the coordinates of B, I found A but I can't seem to get the right answer for B.

Fill in the Blank with the correct verb take . She has___ Her medicine on time

Complete the square to transform the expression x2 + 4x + 2 into the form a(x − h)2 + k. (1 point) (x + 2)2 − 2 (x + 2)2 + 2 (x + 4)2 − 2 (x + 4)2 + 2

find angle y If the opposite side is 12 and the adjacent side is 11mm

What did columbus get in recognition for his discovery of new lands?

Consider the following two data sets. Data Set 1: 8 16 20 35 Data Set II: 5 13 17 32 Note that each value of the second data set is obtained by subtracting 3 fr

Identifique los pares ácido-base conjugados en cada una de las siguientes reacciones: a) CH₂COO + HCN — CH₂COOH + CN™ H₂CO3 + CO²- HPO + NH − CHẠNH; + CIO HCO3

Find the difference. $\left(\frac{9}{4}x+6\right)-\left(-\frac{5}{4}x-24\right)=$