freddiedaniels1 freddiedaniels1
  • 14-12-2016
  • Mathematics
contestada

help me with number two

help me with number two class=

Respuesta :

sail23
sail23 sail23
  • 14-12-2016
5 (92 - 18) = 
5 (74) = 370

Answer Link

Otras preguntas

2+9*3^4 My mother put screen time on my phone. And I also can’t delete some apps for some reason so the time doesn’t delete as well. any solutions? (I was on we
What did the experiments of Griffith and Avery show about genetic information ?
Calculate the mass of each element in the compound by multiplying its molar mass by the number of moles of the element present in one mole of the compound Mass
Darwin was influenced to propose evolution by natural selection based on changes that farmers are able to obtain by means of __________ selection.
What to expect in life science test for term one
Kaylee drove 50 miles an hour for 3 hours. How far did she drive?
Put these numbers in order from least to greatest: 8.21 8.7 8.84 9.1
Jared made a scale drawing of his classroom for his tech project. He used a scale of 1 cm = 3.5 ft. If the length of his classroom on the drawing measured 30 cm
Name four functions of cortisol.​
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein