fmfhmgmjg345
fmfhmgmjg345 fmfhmgmjg345
  • 12-07-2021
  • Mathematics
contestada

hope anyone help me please​

hope anyone help me please class=

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 12-07-2021

9514 1404 393

Answer:

  a) Lahulspiti: -8; Srinigar: -2; Shimla: 5; Ooty: 14; Bengahuru: 22

  b) 30

  c) 6

  d) yes; no

Step-by-step explanation:

a) The values are read from the graph.

__

b) 22 -(-8) = 22 +8 = 30 . . . . difference between highest and lowest

__

c) -2 -(-8) = -2 +8 = 6 . . . positive difference

(Technically, the difference between L and S is L - S = (-8) -(-2) = -6.)

__

d) -2 + 5 < 5 . . . . true

  -2 + 5 < -2 . . . . false

Answer Link

Otras preguntas

Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation? a. insertion mutations only occur during transcription
What advice would you give someone whose life dream is to become a judge?
With the two endpoints of a diamter how many right triangles can be formed
With this sole proprietorship, who pays the taxes?
Which constitutional amendment allowed voting for citizens who were eighteen or older?
The right to a trial by jury in a criminal case is outlined in which amendment?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side
Please help me with this
[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?