2070644 2070644
  • 13-12-2016
  • Biology
contestada

why is the surface area of a cell important to the life of a cell?

Respuesta :

Michaellewis6341 Michaellewis6341
  • 13-12-2016
The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume.
Answer Link

Otras preguntas

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
why is the square root of a perfect square always rational
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
What are the factors of 6x + 24?
Solve the equation -10 + 3x + 5x = -56 ? ??