jaydabruner jaydabruner

14-06-2021
Spanish

contestada

What is the representative animal of the Quechua culture?

llama

horse

goat

Respuesta :

jenaviemagdaleno05 jenaviemagdaleno05

14-06-2021

The llama is the representative animal

Answer Link

Otras preguntas

Why is the population density of the tundra so small?

PLEASE HELP I NEED A ANSWER How many triangles can be constructed with angles measuring 10º, 80º, and 90º? more than one none one

A flooring company needs to purchase carpet to cover the hallway in a home completely. What is the minimum amount of carpet the flooring company needs to purcha

Mary ran 26 miles to train for a marathon. Dylan ran 125% of the number of miles that Mary ran. How many miles did Dylan run? please help!

Divide . round your answer to the nearest tenth 48,052 ÷7=

5(8k + 9m) simplified expression

Is (5,0) a solution of the graphed inequality?

If there is a boy to girl ratio of 3:4, how many girls are there if there are 18 boys? Complete the table to determine the answer. Boys Girls

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

3.How does executive privilege conflict with the principle of checks and balances?