babykristhel200684 babykristhel200684

01-06-2021
Mathematics

contestada

What is the quotation -3/8 divided by -1/4

Respuesta :

engelle engelle

01-06-2021

Answer:

3/2

Step-by-step explanation:

Answer Link

mathstudent55 mathstudent55

01-06-2021

Answer:

3/2

Step-by-step explanation:

-3/8 / -1/4

Negative divided by negative is positive.

To divide by a fraction, change the division to a multiplication and flip the fraction.

-3/8 / -1/4 =

= 3/8 * 4/1

= 12/8

= 3/2

Answer Link

Otras preguntas

What do the doctor and gentlewoman see lady macbeth doing? what do they decide to do about it and why? how has lady macbeth changed since the beginning of the p

If an atom loses a neutron, what happens? (4.10)

Based on what you have read, why does St. Augustine appear to see no conflict between faith and reason?

You push a 4.9 kg block against a horizontal spring, compressing the spring by 16 cm. then you release the block, and the spring sends it sliding across a table

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

A rectangular goat pen has an area of 40 square meters. Its perimeter is 26 meters. What are the dimensions of the pen?

How many nations were originally involved in the creator of the United actions?

How can i simplify this monomial?

Which reasons and evidence does Reagan use to support his argument? Check all that apply.

por que se le llama “blue zone” a nicoya?