jdbr2aakps
jdbr2aakps jdbr2aakps
  • 13-05-2021
  • Mathematics
contestada


Can somebody help me

Can somebody help me class=

Respuesta :

samanthamarin123 samanthamarin123
  • 13-05-2021
-6.8 is the opposite of 6.7
Answer Link

Otras preguntas

Alice changes size several times. The ratio of her orginal height to her second height is 24 to 5. The ratio of her second height ot he rthird height is 1 to 12
please help !!!!!!!!!
Someone know if are correct or incorrect? Please type if you know what goes with what :)
AB= 6 cm, AC = 12 cm Calculate the length of CD. Give your answer to 3 significant figures. C D 55° 12 cm B 6 cm A
can someone please help me with this
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
The distance between Columbus, Ohio, and New York City is about 560 miles. How many hours would it take the train to travel between the cities?
Eva needs to lease out a music studio to record her new album. The studio charges an hourly fee of $50 and an initial studio-use fee of $100. Make a table of va
2-117 Copy each expression and then simplify it without using a calculator. Be sure to show all steps
The length of a rectangle is five times its width. If the area of the rectangle is 245 ft^2 , find its perimeter.