RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the mRNA in TACCGGATGCCAGATCAAATC?

Respuesta :

yolzz
yolzz yolzz
  • 02-05-2021

Answer:

AUGGCCUACGGUCUAGUUUAG

Answer Link

Otras preguntas

Oil is transported in liquid form since it is... A. easier B. richer C. already in a pipe D. none of these are correct
A hot-air balloon is moving on a bearing of 2450 at 31mph. A wind is blowing with the bearing of 2600 at 23mph. Find the component form of the velocity of the
Water has a high specific heat. What effect does this have on aquatic ecosystems? a. they all have the same thermal stratifications b. they can easily become
A ____ is an incorrect assumption about an entire group of people. A.stereotype B. Episode. C.desolation. D.blunder.
How many words are in the scientific name for a species using the linneaus classification system?
how does meditation make you feel ?
PLEASE HELP ME!!! Which statement shows the associative property of addition? (u + 7) + 13 = u + (7 + 13) If m + 3 = 18, then 18 = m + 3. 3⋅(5⋅x)=(3⋅5)⋅x 21 + 2
Solve for xxx. Give an exact answer in simplified form. 54x+64≥49x+59
Read the excerpt from “Land For Free.” The Bauer family was making their way west to find railroad work. They had stopped to rest their oxen when they saw a no
which event would most likely cause a change in a genetic sequence in an organism