leakehailee leakehailee

11-03-2021
History

contestada

How did the Industrial Revolution affect the rise of labor

Respuesta :

maryashafait maryashafait

11-03-2021

Answer: During the Industrial Revolution, the working conditions in factories, mills, and mines were terrible. ... They joined together and created unions in order to fight for safer conditions, better hours, and increased wages.

Explanation:

Answer Link

Otras preguntas

Given f(x) = 3x + 5, describe how the graph of g compares with the graph of f. g(x) = 3(0.1x) + 5

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Explain what the vertical line test is and how it is used

Choose the equation that represents the graph shown

Consider the equation and the following ordered pairs: (1,y) and (x,3). 6x+1.2y=−2.4 Step 1 of 2: Compute the missing x and y values so that each ordered pair w

How do you know UK wearher is becoming more extreme?

According to experts, what percentage of communication is nonverbal? A.32% B.7% C.70% D.93%

8 8.3 8.8.3 a) How many sticks would be in pattern number 6? b) How many sticks would be in pattern number n?

Thomas weighs 168 pounds how many kilograms does Thomas weigh? use a ratio to find the solution (use 0.48 kilogram=1 pound

This is part of a bus timetable between Birmingham and Coventry. Birmingham 07 05 07 33 08 08 08 38 09 05 09 34 a) How many minutes Yardley 07 24 07 53 08 28 08