Seudónimo Seudónimo
  • 12-02-2021
  • Mathematics
contestada

evaluate q-- r if q = -- 14 and r = -- 6.

Respuesta :

greenforestaz
greenforestaz greenforestaz
  • 14-02-2021

Answer:

what is --? The question is incorrect.

Answer Link

Otras preguntas

HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +
Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi
_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol
CAN SOMEONE HELP ME PLEASE ?
4 (2x-6)=10x-6. solve for x
[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?
Which of the following best describes the rights given to the citizens of Jamestown by the Virginia Charter of 1606?
NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why would a signature item, such as distinctive button or tag, be considered a need even if it was not essential to the item’s function? -f someone powerful in