hunterstone23 hunterstone23

02-11-2016
Computers and Technology

contestada

How are suites or sets of applications (such as Microsoft Office) beneficial to users?

Respuesta :

benbram5701 benbram5701

02-11-2016

They enable the user to work more efficiently with a variety of programs.

Answer Link

Otras preguntas

In Hard Times by Charles Dickens, why does the government official object to depicting horses on wallpaper and flowers on rugs? He has doubts about the value of

This composite shape is a rectangle with a semicircle attached on one end. The diameter of the semicircle is 6 feet.What is the approximate area of this composi

When you run to catch a ball, your movements are planned and controlled from the?

The federal government has tried to pressure states into accepting national speed limits and national drinking ages by A) withholding highway funding. B) clos

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

In the case roe vs wade, the supreme court ruled that state laws?

what is the simplest form of 4(y+2)-2

In traditional societies, material possessions were _____. in industrialized societies, material possessions are _____.

A scale model of an airplane has a length of 19 centimeters and a wingspan of 18 centimeters. The length of the real airplane is 38 meters. What is the wingsp

What was the real catalyst to drive the states to unite?