BAJSJSJDJDJDJ BAJSJSJDJDJDJ
  • 01-02-2021
  • Mathematics
contestada

1
10x – 3 (x – 2y) + = (6x + 8y)
2

Respuesta :

ellis445446
ellis445446 ellis445446
  • 01-02-2021

Answer:

x=2y

Step-by-step explanation:

Answer Link

Otras preguntas

the table shows the number of cups of water required when cooking different amounts of rice​
All students in first period are asked what their favorite food is bias or unbiased
Explain the problem that could result from the mishandling of public property​
David wants to buy 2 pineapples and some bananas. The price of 1 pineapple is $2.99. The price of bananas is $0.67 per pound. David wants to spend less than $10
what are the similarities and differences between care at hospital and care at home
As the territory of Africanized bees continues to expand, what is the most likely outcome?
Briana will use a ⅕ gallon pitcher to fill an empty 8/10 gallon jug for her lemonade stand. How much lemonade will she need in order to completely fill the jug?
help me, please How will you end your proposal with the Pasteurization?
Cylinder A has a volume of 6 cubic units, and a height of 3 units. Cylinder B has the same base area and height, but its slant height is 4 units. What is the vo
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein