cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

The sum of two numbers is 66. Two times the smaller number is 15 more than the larger number. What are the numbers? First one will be awraded

what are the side lengths of an equilateral triangle with a perimeter of 8 1/4?

What is the slope of the line through (-1,-7) and (3,9)

When number N is increased by 60% it becomes equal to number 50 decreased by 20%. Find the value of N.

Your friend's house is 4.5 miles north and 6 miles east of the firehouse. How far is your friend's house from the firehouse?

What is 887^3 Pleeeaaase help

Susan sold half of her comic books and then bought 8 more She now has 13. How many did she begin with

can somebody solve this for me? thank you

Carl drove from his house to work at an average speed of 35 miles per hour. The drive took him 25 minutes. If thedrive home took him 30 minutes and he used the

Solve the following equation. 2x/5 + 1 = 7 (The 2x/5 part is supposed to be a fraction, with the numerator being 2x and the denominator being 5)