rafarodriguez1920 rafarodriguez1920

03-12-2020
Biology

contestada

Which of these is a characteristic of warm air?
It transfers energy through radiation.
O Its molecules are far apart.
O it sinks due to convection.
o It cools the land below it.

Respuesta :

annar62716 annar62716

03-12-2020

answer: it’s molecules are far apart

Answer Link

Otras preguntas

What is the value of x?

Find the volume of the prism?*

PLEASE HELP ASAP WITH THESE!!

4 1/8 take away 1 1/2 mixed numbers

Who gave ghanna a Military advantage over its neighbors to

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

PLZZZ HELP!!! Select the correct answer. A testing team has a new software application to test. While writing the test plan, the team enters some functions that

What is the equation for the line that passes through the points (-5.5, 2.5) and (-2.5, -3.5) questions are: A) y= 2x + 13.5 B) y= x - 1 C) y= -2x + 1.5 D) y= -

Help if you can no links please What happens at a cell cycle checkpoint?

There are three species of birds on an island. Bird A has a heavy bill for eating seeds. Bird B has a pointed bill for eating insects. Bird C has a sharp bill f