celestegaona12 celestegaona12

15-11-2020
History

contestada

Please help! Will mark you the brainiest

Please help Will mark you the brainiest class=

Respuesta :

DuckieR11 DuckieR11

15-11-2020

Answer:

B

Explanation:

I believe it is b

Answer Link

JaredWyatt8481 JaredWyatt8481

15-11-2020

Answer:

D.

Explanation:

If it's a cycle it's not just going to say a good or bad thing one of the dynasties did.

Answer Link

Otras preguntas

The accounting equation can be stated as A. Expenses = Liabilities - Owner's Equity B. Assets - Liabilities = Owner's Equity C. Liabilities = Revenue + Owner's

What do you think a "Buffalo Soldier" is? What do you think their job was based on their name?

Maria weighs 55 kilograms. What is her weight in pounds?

This map illustrates

For this assignment, you will describe and compare the powers and responsibilities of each branch of the federal government. To do this, you will complete the f

what action taken by the Soviet Union created tensions between the soviet government and tbe government of the united states and its allies?

Identify the amendment A. Amendment 4 B. Amendment 2 C. Amendment 1 D. Amendment 10

Write each mixed number as a percent. 1. 2 1/2 2. 9 3/4 3. 4 1/5 4. 7 3/10

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

площадь параллелограмма сторона которого равна 4,7 см а проведённая к ней высота 3,1