eduardoosorto81
eduardoosorto81 eduardoosorto81
  • 14-10-2020
  • Mathematics
contestada

I need it asap HELP ME PLEASE​

I need it asap HELP ME PLEASE class=

Respuesta :

kanemoon04
kanemoon04 kanemoon04
  • 14-10-2020

Answer:

x=-38

Step-by-step explanation:

8x+51=6x-25

2x= -76

x= -38

Answer Link

Otras preguntas

A solar eclipse will last 1 to _____ minutes. A) 3 B) 7 C) 15 D) 30 How many solar eclipses occur per year? A) 2 B) 4 C) 6 D) 8 Is it safe to view a solar ec
How do you find if this is a right, obtuse, or acute triangle?
Which property makes radio waves most useful for communication? They have low frequencies. They have long wavelengths. They transfer low amounts of energy.
You had several of your​ son's friends over last night for a sleepover. while dropping off their​ child, one of the parents did not see your basketball hoop and
When discussing the dimensions of temperament, what is the term used to refer to the proportion of active time periods to inactive time periods demonstrated by
What are the ways that a Republican state chairman can become a member of his party's national committee? Select all that apply.
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
which statement best describes the process that produced the ending populations of moths
What important question do the various research techniques lack the ability to answer?
Activated cytotoxict cells (t lymphocytes) __________. flag cells for destruction by macrophages differentiate into plasma cells that secrete antibodies bind to