nicolecavazos0420 nicolecavazos0420
  • 14-10-2020
  • Mathematics
contestada

3. What is the solution set of the equation 3x + 5) = x + 2?

Respuesta :

baileylaniyah baileylaniyah
  • 14-10-2020
the solution set of 3x+5=x+2 is x=-1. This is because you want to get the variables on one side and the numbers on the other. you subtract x on both sides and subtract 5 on both sides. your equation then becomes 3x=-3. you then divide 3 on both sides and you get your answer of x=-1.
Answer Link

Otras preguntas

Please help me out with this
Which american colony was established in the 1660s as a haven for quakers?
Please help ASAP!!!! 100 points!
Groups that are more formal and require less continuous interaction are known as what type of​ group?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
In a standard normal curve, what percentile corresponds to a z-score of 2.0?
What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine
Which English reformer called for change in the church during the 1300's
Can someone Help me with that please
Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new