i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the complementary DNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the complementary DNA sequence for the DNA strand above class=

Respuesta :

KurdishPotato KurdishPotato

13-10-2020

Answer:

Option D)

Explanation:

In the DNA strand A comes accross Tç and C comes across G

The option justifies this rule is D)

Answer Link

13-10-2020

The picture doesn't work for me.. sorrry

Answer Link

Otras preguntas

(8x²+34x+25)÷(2x+7) I need a quotient and a remainder

the sum of two different numbers is 5.the difference if twice the first number and the second number is 7 . what are the two numbers

One large submarine sandwiches is divided equally among four people how much of the sandwich did each person receive

The temperature of a city was -12 degrees Fahrenheit in the morning. The temperature rose by 4 degrees Fahrenheit in the afternoon. What is the temperature of

For each exercise draw circle O with radius 12. Then draw radii OA and OB to form an angle with the measure named. Find the length of AB. Answer for each of the

Which of the following was a cause of the pullman strike of 1894. (A)Public assistance should be available for the poor (B)Large corporations are inherentl

A sewing club used 48 feet of fabric to make 8 blankets. At this rate how many blankets can be made from 12 yards of fabric?

I don't know what the answer is to divide 180 in a ratio of 4:5:9

If you had a pure sample of the element (no other elements mixed in), describe its appearance... my element is sodium

In 1910, after many years of political instability, people in Mexico