i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

The table shows monthly profits and losses for Whitney's juice shop for a 6-month period. What is the net profit or loss for all six months? Two row table

Write one number that is a factor of 13

An aquatic food web consists of phytoplankton → krill → seals → sharks. The removal of which component is MOST LIKELY to cause an immediate impact on the food w

6x-3y=20 through (4,-3)

some people wrongly compare the cells inside the body with bricks in a wall.actually three are scores of difference between the two and one such difference is t

What happend on summer 1943? 2. World war

Part of the process of cellular respiration is shown below. sugar + Substance 1 Substance 2 + water + energy What is the missing product in the process of cell

According to the new Constitution, which official of the federal government would be elected directly by the people?

What if the 360 cubic-inch paving stones are 4 inches thick and any whole number length and width are possible? How many different paving stones could be made?

Which statement about regular exercise is NOT true? A-To benefit from physical activity you should find one type of exercise that suits you best and stick to it