sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

Please help Me Water’s specific heat is ______ Joules

An aerosol can contains 350.mL of gas at a pressure of 5.00 atm. What would be the volume of the gas at 2.00atm?

. A honeybee leaves the hive, traveling at a speed of 4 mph and returns 1 hour later. What was the distance traveled and the displacement of the honeybee in mil

Read the excerpt from "Rhapsody on a Windy Night." So the hand of a child, automatic, Slipped out and pocketed a toy that was running along the quay. I could se

DNA is composed of four nucleotides what are they?

Guys Please help I have no idea what the answer is

Question 8 (1 point) ¿Cómo dirías "we get up"? o me levanto te levantas se levanta nos levantamos

. A sample of 250 cans of peas showed an average weight of 14 ounces with a standard deviation of 0.7 ounces. If the distribution is relatively normal, how many

The ratio of the perimeter of a square to the length of a rectangle is 5:6.The ratio of the length to the width of the rectangle is 3:2.The perimeter of a recta

My alarm went off just to spite me.* O Metaphor O Personification O Hyperbole O Simile 0 Idiom