sawyerdamiano sawyerdamiano
  • 14-09-2020
  • Mathematics
contestada

Please answer soon :)

Please answer soon class=

Respuesta :

addicatsansfangirl
addicatsansfangirl addicatsansfangirl
  • 14-09-2020

Answer:

55%, or C.

Step-by-step explanation:

There are 20 marbles in the bag. 9 of them are red, and 11 of them are another color. Percentages consist of a part of 100, so you would have to make your denominator (20) into a 100. To do this, simply multiply the 20 by 5. Since you did this with 20, you have to do it with your 11 non-red marbles as well. This would be 55. Put the two together, and you have 55/100. What is 55/100 in percentage form? 55%!

Hope this helped! :-D

Answer Link

Otras preguntas

Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
who was the founder of Pennsylvania?
A vehicle is only 15% efficient. What happened to the other 85%?
How many years does an apple tree live useful?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Fossils are most commonly found in which type of rock?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
What is the primary purpose of the Supremacy Clause?
Which word has the long i sound? relieve speciality society social