bernardjessica055 bernardjessica055

02-09-2020
English

contestada

What is the best central idea of the text

Respuesta :

M4dfi5h M4dfi5h

03-09-2020

Answer:

the first statement of the text best identifies the central idea

Explanation:

Answer Link

Otras preguntas

x to the 2 power plus 4x plus 3[tex]x{2} + 4x + 3 = [/tex]

stuck i need help please

If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

Both Ghandhi and king set which type of mood in their introduction

How many meters are there in 21 feet?

Do you think there are benefits to teaching prisoners about philosophy?

What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +