oterianno oterianno
  • 04-11-2014
  • Chemistry
contestada

which elements make up a family

Respuesta :

Renan1234 Renan1234
  • 04-11-2014
The columns going up and down on the periodic table of elements are familys
Answer Link
vivio
vivio vivio
  • 04-11-2014
The columns in the periodic table. They're also known as groups.
Answer Link

Otras preguntas

A, an, and the are signal words. True False
The messages between the lines (was/were)that we needed to finish before Monday.
write a use of calculating dependency ratio​
help me out with my homework ​
A gas system contains 2.00 moles of O2 and CO2 gas, has an initial temperature of 25.0 oC and is under 1.00 atm of pressure. If the pressure remains constant an
Someone please help me!!
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
somebody please solve this!!!​
A rental car agency charges $220.00 per week plus $0.25 per mile to rent a car. How many miles can you travel in one week for $400.00? The number of miles you c
Help on this one please