afisher9275
afisher9275 afisher9275
  • 02-06-2020
  • Mathematics
contestada

8=72
2=6
5=30
9=?

what is the value of ?

Respuesta :

2804704U 2804704U
  • 02-06-2020

Answer:

108?

Step-by-step explanation:

Answer Link
Аноним Аноним
  • 11-06-2020

Answer:

108

Step-by-step explanation:

9×12=108

8(9) is72

2(3)is 6

5(6) is 30

9( ×12 +a{6}) is 108

Answer Link

Otras preguntas

· Born a slave in Walton County in 1858 · Owned and operated 3 barbershops in Atlanta in 1904 · Started Atlanta Life Insurance Association · Atlanta's first Af
Jill Hartman earns $750 per week, plus 3% of sales in excess of $6500. if Jill sells $25000 in the first week her earnings are ? A) $1503B ) $1500c) $945d) $130
Which animal has the most amount of available energy?
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
What country's king sponsored ferdinand magellan's journey around the world?
Because of land lotteries in Georgia, the Creek Indians A) were displaced from their homes and their land. B) moved west to escape the rule of the governm
40÷blank= 6 reminder 16
George is helping the manager of the local produce market expand her business by distributing flyers around the neighborhood. He gets paid $20 a day as well as
Which sentence implies that the two men are going to follow Mr. Taft?
Which of the following statements is NOT true about Isabella d’Este? A. She was considered a true Renaissance woman because she was a doer and a thinker. B.