Yeezyadikst2344 Yeezyadikst2344

13-05-2020
English

contestada

Can you guys answer this question ASAP, thanks will mark brainliest

Can you guys answer this question ASAP thanks will mark brainliest class=

Respuesta :

rebelsofthecentury6 rebelsofthecentury6

13-05-2020

Answer:

i think its joining them in marriage

Explanation:

Answer Link

yaluristorres yaluristorres

13-05-2020

The answer should be the last option giving them a drug that will help them to sleep.

Answer Link

Otras preguntas

With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?

Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.

Help! Exponential Equation WITHOUT CALCULATOR

An element's atomic number is 64. How many protons would an atom of this element have?

Mi abuelo no es joven. Es _____

Sam is eating a Big Hamburger. The first bite was 20% of the Hamburger, the second bite was 20% of what is left and so every next bite is 20% of what is left. a

The wealth and prosperity of mali and songhai were dependent on controlling the trade in

Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat